Fuster-Garcia C, Garcia-Garcia G, Gonzalez-Romero E, Jaijo T, Sequedo MD, Ayuso C, Vazquez-Manrique RP, Millan JM, Aller E (2017). USH2A gene editing using the CRISPR system. Mol Ther Nucleic Acids 8:529-541.

I. PRELIMINARIES

1. Ever-present question #1: What is your goal in looking at this article?
   Answer: To prepare for your representative a position paper that describes the prospects for curing Usher syndrome by means of genome editing.
   Don't bother yourself with details in the article that are not relevant to your task.
    
2. Ever-present question #2: What concepts/terms do you not understand and you suspect are worth your time in order achieve your goal?
    
3. The first step in reading an article is generally to see what you're up against. Quickly skim the article and note what sections there are. Create an outline. Perhaps you can see which sections will be most useful, or perhaps not. As you figure out more about the article, fill in your outline. One popular addition to an outline is "This section is irrelevant to my goal".

II. INTRODUCTION

1. Paragraph 3, Sentence 1 speaks of a large sequence with a specific GenBank ID. Find this sequence by doing the following:
   • Go to the National Center for Biotechnology Information (NCBI) website (available from the SoGem website, Resources and Links)
   • Change All Databases to Nucleotides (because you want to get a nucleotide sequence)
   • Enter the GenBank ID into the large blank white box
   • Click Search
2. What is the size of the sequence? Why is there a discrepancy with the size stated in the first sentence?
    
3. Why might a sequence of this size make gene substitution therapy difficult? (You probably don't know, so guess)
    
4. Paragraph 3, Sentence 4 talks about two mutations in exon 13 of USH2A. Go to the GenBank sequence and identify that exon. What are its coordinates?
    
5. Why might it be an advantage (as they claim) that the two mutations are in the same exon? What if they were in different exons? (you might want to wait on this question until you've progressed further in the article)
    
6. Paragraph 4 refers to Figure 1A. Are the sizes of the exon boxes shown at the top of the figure proportional to the actual sizes of the pertinent exons listed in the GenBank file?
    
7. Why are the boxes separated in Figure 1A but the coordinates of adjacent exons in the GenBank file are contiguous?
    
8. What is the relationship between the sequence shown in Figure 1A and the sequence you got from GenBank? Find the sequence.
    
9. What are "c.2276G>T" and "c.2299delG"? What is the significance of their numbers? Why those exact numbers?
    
10. What is the relationship between Figures 1A and 1B? Copy the figure into a word processor or Powerpoint-like program and highlight the connection.
     
11. What is the goal of the experiment? (You might also want to take a peak at the beginning of the RESULTS section)

III. RESULTS
A. USH2A Exon13 Editing in HEK293 Cells

1. In the end, is the stated goal of this section actually addressed? In what way yes? In what way no?
    
2. What are sgRNA-1, -2, -3, and -4? What is the sequence of (for example) sgRNA-3? Why is the PAM trinucleotide to the left of sgRNA-3 and -4 but to the right of sgRNA-1 and -2?
    
3. It would be nice to know whether this CRISPR idea actually works under the authors' conditions. What is the evidence that CRISPR/Cas9 and different sgRNAs actually act on Exon13? What is a T7-endonuclease assay? (a trip to the MATERIALS and METHODS section might help. Or not.)
    
4. (Looking at Fig. 2A) What is the significance of the numbers heading eight of the ten columns?
    
5. Why are there three bands for each column except the far left and far right?
    
6. What is the significance of the far right column? Far left column?
    
7. Where do the numbers at the bottom of Fig. 2A come from? Try calculating them yourself (note the formula in the MATERIALS and METHODS section) (How can you rationalize that formula?)
    
8. At this point, what can you tell your representative?
    
9. (Looking at Fig. 2B) What do the 9 lines of sequences represent?
    
10. Before you try to interpret the figure, I suggest you help out the authors and reformat it. I've reproduced the sequences below. Copy them into a word processor and reformat, forcing the right ends to be flush right, adding hyphens as needed to make this happen. Once you've done this, examine your handiwork and describe the relationship between the sequences. You can do this in a single well chosen sentence.

    GAACAAATTCTGCAATCCTCACTCTGGGCAGTGTGAGTG
    GAACAAATTCTGCAATCCTCACGTCTGGGCAGTGTGAGTG
    GAACAAATTCTGCAA-------TCTGGGCAGTGTGAGTG
    GAACAAATTCT--------------GGGCAGTGTGAGTG
    GAACAAATTCTGCAATCCTCA-TCTGGGCAGTGTGAGTG
    GAACAAATTCTGCAATCCTCACCTCTGGGCAGTGTGAGTG
    GAACAAATTCTGCAATCCTCAC--------GTGTGAGTG
    GAACAAATTCTGCAATCCTCACATCTGGGCAGTGTGAGTG
    GAACAAATTCTGCAATCCTCACT--GGGCAGTGTGAGTG

11. Were the results of Figure 2 produced within the cell using non-homologous end-joining or homology-directed repair? Why do you say so, from the protocol? Why do you say so, from the resulting sequences? Were the desired genome changes introduced?
     
12. Describe single-stranded oligodeoxynucleotide repair in a language your representative can understand. Make use in your narrative of Figure 3A, top line (or something better if you like). Be sure you describe the relationship between sgRNA-1, genomic DNA, and the oligonucleotide sequence. You might want to base your answer on a more comprehensible figure from your review article.
     
13. What is the point of the TGGGCA --> TGGCCA change introduced in the oligonucleotide? What is MlsI? Its significance?
     
14. After looking at Fig.3B, what can you tell your representative?